ORIGINAL RESEARCH ARTICLE
Full Access
Activating Mas receptor protects human pulmonary microvascular endothelial cells against LPS-induced apoptosis via the NF-kB p65/P53 feedback pathways
Weifeng Huang, Yongmei Cao, Yujing Liu, Feng Ping, Jiawei Shang, Zhongwei Zhang, Yingchuan Li,
First published: 07 December 2018
https://doi-org.libproxy.uccs.edu/10.1002/jcp.27951
Abstract
The balance between Ang II/AT1R and Ang-(1-7)/Mas plays a pivotal role in the development of lipopolysaccharides (LPS)-induced acute respiratory distress syndrome. However, the mechanisms underlying the balancing process still remain unclear. Here we investigated the roles of nuclear factor (NF)-κB and p53 in regulating AT1R and Mas expression. The results demonstrated that Ang II pretreatment resulted in downregulation of Mas and upregulation of AT1R, phosphorylated p65, and apoptosis in LPS-treated Human pulmonary microvascular endothelial cells (HPMVECs), but had no effect on p53 expression. Lentiviral vector-mediated P65 knockdown, but not a P53 knockdown, reversed all these effects of Ang II. On the other hand, Ang-(1-7) pretreatment lead to an increased in Mas expression and a decrease in AT1R, p53, and phosphorylated p65 expressions with suppressed apoptosis in LPS-treated cells. P65 knockdown promoted the protein expression of both AT1R and Mas while inhibiting p53 expression. P53 knockdown, but not a p65 knockdown, reversed all these effects of Ang-(1-7). Interestingly, p65 overexpression upregulated p53 and AT1R but downregulated Mas. P53 knockdown activated p65. These results suggest that there is a two-way feedback regulation between AT1R and Mas receptor via the NF-kB p65/P53 pathway, which may play a key role in LPS-induced HPMVECs apoptosis.
1 INTRODUCTION
Acute respiratory distress syndrome (ARDS), an inflammatory response, is characterized by severe hypoxemia and acute respiratory dysfunction (Herridge & Angus, 2005; Mikkelsen et al., 2013; Rubenfeld et al., 2005). ARDS is a common and devastating syndrome and is associated with high risks of long-term morbidity and mortality. Despite advances in treatment options, ARDS patients still have a mortality rate above 30% (Bachofen & Weibel, 1982; Matute-Bello et al., 2011; Matutebello, Frevert, & Martin, 2008). Both pulmonary and extra-pulmonary factors, such as sepsis, acid aspiration, major trauma, burns, acute pancreatitis, or severe infections, can lead to ARDS (Rubenfeld et al., 2005). Among them, sepsis is the most common stimulus (Phua et al., 2009; Rubenfeld et al., 2005).
Evidence has shown that ARDS impairs the renin–angiotensin system (RAS) in local lung tissues (Imai, Kuba, & Penninger, 2008a). RAS is responsible for maintenance of balance of blood pressure, water, and electrolytes (Passos-Silva, Verano-Braga, & Santos, 2013), and abnormal activation of RAS is implicated in some cardiovascular, lung, liver, and renal diseases (Chou, Chuang, Lu, & Guh, 2013; de Man et al., 2012; Song et al., 2013). Angiotensin-converting enzyme (ACE) and angiotensin-converting enzyme 2 (ACE2) are two important enzymes involved in RAS. ACE degrades angiotensin I to angiotensin II, which triggers inflammation, fibrosis, and apoptosis via a Type 1 receptor (AT1R). ACE2 cleaves a single residue from Ang II to generate Ang-(1-7), which exerts anti-inflammatory, anti-fibrotic, and antiapoptotic effects to counteract the actions of Ang II via the Mas receptor (Imai, Kuba, & Penninger, 2008; Kuba, Imai, & Penninger, 2006). The Ang II/Ang-(1-7) ratio is markedly increased in ischemia-reperfusion-induced mouse models of ARDS, compared with that in normal mice (Chen et al., 2013). Lipopolysaccharides (LPS) elevates bronchoalveolar lavage fluid (BALF) Ang II levels while reducing Ang-(1-7) levels in ventilator-induced lung injury in rats (Wösten-van Asperen et al., 2011) and induces AT1R expression in PMVECs (Tong, Tang, Li, Xia, & Liu, 2016).
In contrast, ACE2 overexpression upregulates the Ang-(1-7) levels in BALF and thus inhibits LPS-induced lung injury, whereas Mas receptor inhibitor abolishes the protective effects of Ang-(1-7) (Zhang & Sun, 2006). In addition, ovalbumin (OVA) induces allergic lung inflammation in mice and inhibits Mas receptor protein expression. Mas receptor agonist treatment reverses the effects of OVA (Rodrigues-Machado et al., 2013). Mechanistically, Mas receptor and AT1R can form a heterologous dimer that blocks AT1R-dependent intracellular signal transmission indicating that the Mas receptor is a physiological antagonist of AT1R (Kostenis et al., 2005). These findings suggest that the imbalanced ratio of AT1R to Mas receptor may contribute to the development of ARDS.
The balance between ACE and ACE2 plays an important regulatory role in the development of ARDS, whereas ACE and ACE2 exert this effect through AT1R and Mas receptor, respectively. Therefore, AT1R and Mas receptor play a crucial role in the regulation process. Currently, little is known about the transcriptional regulation of AT1R, especially of the Mas receptor. Twenty-four P53 protein-binding sites have been identified on the AT1R gene promoter regions, suggesting that AT1R is a direct downstream target of P53, furthermore, P53 overexpression enhances, whereas P53 knockdown suppresses AT1R expression in myocardial cells (Leri et al., 2000). Interestingly, as two important transcription factors, p53 and NF-κB regulate each other positively or negatively depending on the internal environment (Perkins, 2007).
Ang-(1-7) has been found to inhibit the phosphorylation of IκBα and then suppress the OVA-induced lung inflammatory (El-Hashim et al., 2012). Our previous study consistently showed that ACE2 protects against LPS-induced ARDS through Ang-(1-7)/Mas-mediated signaling, which inactivates NF-κB (Li, Cao et al., 2015; Tong et al., 2016). Based on these studies, we hypothesize that the AT1R and Mas receptor may be reciprocally regulated via the p53/ NF-κB pathways.
2 MATERIALS AND METHODS
2.1 Reagents
LPS from Escherichia coli O127:B8, Ang-(1-7), and Ang II were purchased from Sigma-Aldrich (St Louis, MO). A779 (Ang-(1-7)/Mas receptor antagonist) and ARB (AT1R blocker) were obtained from GL Biochem (Shanghai, China). Rabbit anti-AT1R, anti-p53, anti-phosphor-p65, mouse anti-Mas, and anti-β-actin antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Goat antirabbit and horse antimouse IgG horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from Cell Signaling Technology (Danvers, MA). The annexin V: FITC apoptosis detection kit was purchased from BD Biosciences (San Jose, CA).
2.2 Cell culture
HPMVECs were cultured in Endothelial Cell Growth Medium MV (Promocell) containing 15% fetal calf serum, penicillin (100 IU/ml), and streptomycin (0.1 g/L). Cells were grown at 37°C in a humidified atmosphere of 5% CO2.
2.3 Generation of recombinant lentiviruses expressing p65, p53, small hairpin RNA (shRNA)-p65 OR shRNA-p53
Total RNA was extracted from HPMVECs and reversely transcribed into cDNA by M-MLV reverse transcriptase (Takara Bio Inc, Tokyo, Japan). The cDNA was used to amplify the p65 and p53 coding sequence with the following primers: p65, forward: 5′-GCTCTAGAGCCACCATGGACGAACTGTTCC-3′ and reverse: 5′-CGGGATCCTTAGGAGCTGATCTGACTC-3′; p53, forward: 5′-GCTCTAGAGCCACCATGGAGGAGCCGCAGTCAG-3′ and reverse: 5′-CGGGATCCTCAGTCTGAGTCAGGCCC-3′. Three shRNA sequences targeting the rat p65 coding region were as follows: small interfering RNA (siRNA)1–p65 (5′-GATCTGCCGAGTGAACCGA-3′); siRNA2–p65 (5′-GCTGATGTGCACCGACAAG-3′); and siRNA3–p65 (5′-GGACATATGAGACCTTCAA-3′). Three shRNA sequences targeting the rat p53 coding region were as follows: siRNA1-p53(5′-GTCTGTGACTTGCACGTAC-3′); siRNA2-p53 (5′-GCAGTCACAGCACATGACG-3′); and siRNA3-p53 (5′-GACTCCAGTGGTAATCTAC-3′). A random RNA interference (RNAi-control) sequence (5′-GAAGCCAGATCCAGCTTCC-3′) was used as the negative control.
The corresponding shRNA oligonucleotide templates were chemically synthesized. The p65 or p53 PCR products were purified and ligated into a lentiviral pcDNA-CMV-copGFP cDNA vector, and the synthesized shRNA-p65 or shRNA-p53 was ligated into pSIH1-H1-copGFP shRNA (System Biosciences, CA). Each ligation mixture was transformed into competent E. coli strain DH5a, and the resultant plasmids were validated by sequencing method. In accordance with the manufacturer's instructions, the vectors expressing p65 or p53 or p65 shRNA or P53 shRNA and lentivirus package plasmids were cotransfected into 293T producer cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). The supernatants were collected 48 hr later. Total RNA and protein were extracted to detect p65 or p53 messenger RNA (mRNA) and protein. Viral titer was evaluated by serial dilution experiments. The recombinant lentiviruses were defined as Lv-shRNA-p65 and Lv-shRNA-p53.
2.4 Lentiviral transduction
One day after plating, HPMVECs were infected with Lv-shRNA-p65 or Lv-shRNA-p53 and diluted at a multiplicity of infection of 20 in endothelial cell medium that was refreshed 24 hr later. The infection efficiency was assessed by fluorescence microscopy 96 hr after infection. 100 µl of lentivirus-infected (Lv-shRNA-control, Lv-shRNA-p65, or Lv-shRNA-p53) HPMVECs were seeded into 96-well plates (1 × 104 cells/well) and incubated with serum-free Dulbecco's modified Eagle's medium for 24 hr.
The infected HPMVECs were then pretreated with vehicle or 100 nM Ang II or ARB or Ang1-7 or A779 for 2 hr and then stimulated with vehicle or 10 mg/ml LPS for 48 hr as follows: (a) Cells infected with shRNA-control and treated with vehicle (control); (b) cells infected with shRNA-control and treated with LPS only (LPS); (c) cells infected with shRNA-control and treated with Ang II plus LPS (LPS+Ang II); (d) cells infected with shRNA-control and treated with ARB plus LPS (LPS+ARB); (e) cells infected with shRNA-control and treated with Ang1-7 plus LPS (LPS+Ang1-7); (f) cells infected with shRNA-control and treated with a779 plus LPS (LPS+A779); (g) cells infected with shRNA-p65, receivin g Ang II before LPS (shRNA-p65+LPS+Ang II); (h) cells infected with shRNA-p65 and treated with ARB plus LPS (shRNA-p65+LPS+ARB); (i) cells infected with shRNA-p65 and treated with Ang1-7 plus LPS (shRNA-p65+LPS+Ang1-7); (j) cells infected with shRNA-p65 and treated with A779 plus LPS (shRNA-p65+LPS+A779); (k) cells infected with shRNA-p53 and treated with Ang II plus LPS (shRNA-p53+LPS+Ang II); (l) cells infected with shRNA-p53 and treated with ARB plus LPS (shRNA-p53+LPS+ARB); (m) cells infected with shRNA-p53 and treated with Ang1-7 plus LPS (shRNA-p53+LPS+ng1-7); and (n) cells infected with shRNA-p53 and treated with A779 plus LPS (shRNA-p53+LPS+A779).
2.5 Luciferase reporter gene assays
Genomic DNA was isolated from HEK 293 cells, and the promoters of p53, AT1R, and Mas receptor gene were amplified with PCR, and then cloned into the luciferase reporter gene vector-pGL3-Enhancer. These recombinant vectors were defined as pGL3-pro-p53, pGL3-pro-AT1R, and pGL3-pro-Mas. The HEK 293 cells were seeded into six-well plates the day before transfection, followed by cotransfection with pGL3-pro-p53 or pGL3-pro-AT1R or pGL3-pro-Mas and Lv-p65 or Lv-shRNA-p65 or Lv-shRNA-p53 or Lv-NC; a normal control group was also included. After 48 hr of transfection, the cells were harvested for firefly luciferase activity assay using the luciferase reporter assay system (Promega, Madison, WI).
2.6 Western blot analysis
Cells were lysed using T-PER Tissue Protein Extraction Reagent containing the protease inhibitor. Protein lysates were resolved on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel and then transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% bovine serum albumin in tris-buffered saline (10 mM Tris, 150 mM NaCl, pH7.4)/0.1% Tween 20 (TBST) for 2 hr, followed by incubation with a primary antibody against rat AT1R (1:400), Mas (1:500), phosphorylated P65 (1:300), P53 (1:600), and β-actin (1:1,000) overnight at 4°C. After washing with TBST three times, the membranes were incubated with secondary HRP-conjugated antimouse/rabbit IgG. The blots were detected with a chemiluminescence detection kit. β-Actin was used as an internal control.
2.7 Real-time polymerase chain reaction
Real-time polymerase chain reaction (PCR) was performed using the PowerUp™ SYBR® Green Master Mix (Invitrogen) in the Applied Biosystems 7500 Fast Real-time PCR System. The reaction conditions were as follows: hot start (95°C, 2 min), followed by 40 cycles of denaturation and annealing/elongation (95°C, 15 sec; 60°C, 2 min). The specific primers for AT1R, Mas, and β-actin are shown in Table 1. β-Actin was used as the internal control.
Table 1. The primers sequences of target genes
Forward primer
Reverse primer
Beta actin
CCCAAGGCCAACCGCGAGAAGATG
GTCCCGGCCAGCCAGGTCCAGA
NM_001101.3
P53
CGTACTCCCCTGCCCTCAACAAGA
AGGAGGGGCCAGACCATCGCTATC
NM_000546
P65
CTCCGCGGGCAGCATCC
CATCCCGGCAGTCCTTTCCTACAA
NM_021975
Mas
GCGCCAACCCTTTCATTTACTT
CTTTCTGGCGCCGAGGTTG
NM_002377
AT1R
CTTGGGCGTGTGGGCTGTGG
CCCGCGGGTAGAAGATGCTGATG
NM_020350.4
2.8 Cell apoptosis assay
Data were analyzed using CellQuest Pro software (BD, Franklin Lakes, NJ). HPMVECs were seeded to six-well plates at 1 × 105 cell per well and treated with vehicle or 10 mg/ml LPS after 2 hr of pretreatment with 100 nM Ang II or ARB or Ang1-7 or A779. After 48 hours, the cells were collected for apoptosis assay by flow cytometry (fluorescence-activated cell sorting [FACS] Calibur, BD Biosciences) using Annexin V: FITC Apoptosis Detection Kit II (Cat: 556570; BD Biosciences).
2.9 Statistical analyses
Data are presented as mean ± standard deviation. Statistical analyses were performed using the Prism software package (GraphPad v5, San Diego, CA). Data were analyzed using one-way analysis of variance and then the Newman–Keuls test for multiple comparisons; p < .05 was considered statistically significant.
3 RESULTS
3.1 LPS induces HPMVEC apoptosis, phospho-NF-kB p65, and p53 expression, as well as imbalance between AT1R and Mas
LPS is an important inducer for ARDS in which NF-κB, p53, AT1R, and Mas are involved. To investigate the mechanisms underlying LPS-induced ARDS, we treated HPMVECs with LPS and found that LPS can effectively induce HPMVEC apoptosis (Figure 1a), a key process in ARDS. Importantly, LPS also significantly upregulated the AT1R expression while downregulating Mas expression (Figure 1b), along with the marked induction of both phospho-NF-κB p65 and p53 (Figure 1c). These results suggest that LPS-induced HPMVEC apoptosis may cause the imbalance between AT1R and Mas, as well as activation of the NF-κB/p53 pathway.
Figure 1
Open in figure viewerPowerPoint
Effects of LPS on apoptosis, AT1R, Mas, phospho-NF-kB p65, and p53 expression in HPMVECs. LPS exposure caused a significant apoptosis (Figure 1a), increased AT1R expression, and inhibited Mas expression level (Figure 1b) in HPMVECs. In addition, LPS also induced a marked increase of both phospho-NF-κB p65 and p53 (Figure 1c). All data are expressed as the mean ± SD from at least three replicate experiments. *p < 0.05 versus the control group. LPS: lipopolysaccharides; HPMVECs: human pulmonary microvascular endothelial cells; SD: standard deviation [Color figure can be viewed at wileyonlinelibrary.com]
3.2 NF-κB activates p53 and AT1R transcription while inhibiting Mas transcription
HPMVECs were infected with lentiviral vectors expressing p53, NF-κB p65, shRNA-p53, and shRNA-NF-κB p65, and lentiviral-mediated gene transfer can regulate p53 and p65 expressions in HPMVECs efficiently. To examine whether the NF-κB/p53 pathways affect AT1R/Mas, we transfected p65- or p53-deficient and -overexpressing HPMVECs with p53, AT1R, and Mas promoter constructs. As shown in Figure 2a,b, p65 overexpression by lentiviral vectors significantly promoted p53 and AT1R promoter activity, but had no effect on Mas promoter activity (Figure 2c). Interestingly, knockdown of either p65 or p53 markedly increased Mas promoter activity (Figure 2c). These results suggest that NF-κB/p53 pathways may contribute to the imbalance between AT1R and Mas via direct or indirect regulation of AT1R and Mas transcription, and NF-κB appears to be an upstream regulator of p53.
Figure 2
Open in figure viewerPowerPoint
Effects of either p65 or p53 on p53, AT1R, and Mas promoter activity in HPMVECs. The p53, AT1R, and Mas promoter activity in HPMVECs were detected by using luciferase reporter assay. The P65 overexpression promoted p53 and AT1R promoter activity, significantly, but had no effect on Mas promoter activity (Figure 2a–c). Knockdown of either p65 or p53 inhibited AT1R promoter activity and upregulated Mas promoter activity (Figure 2b,c). All data are expressed as the mean ± SD from at least three replicate experiments. *p < 0.05 versus the pGL3-Pro-P53 group; #p < 0.05 versus the pGL3-Pro-AT1R group; $p < 0.05 versus the pGL3-Pro-Mas group. AT1R: Angiotensin II receptor type 1; SD: standard deviation [Color figure can be viewed at wileyonlinelibrary.com]
3.3 P53 inhibits the Mas expression, but not the AT1R expression
Because p53 transcription can be regulated by NF-κB, and the NF-κB/p53 pathway plays a role in imbalance between AT1R and Mas, we examined whether p53 alone affects the AT1R/Mas balance. As shown in Figure 3a,b, p53 had no effect on the AT1R mRNA expression, but negatively regulated the Mas mRNA expression as evidenced by downregulation of Mas by the p53 overexpression and upregulation of Mas by p53 knockdown. These results indicate that the AT1R expression is independent of the p53 pathway.
Figure 3
Open in figure viewerPowerPoint
Effects of p53-overexpressing and -deficient vectors on AT1R and Mas mRNA levels in HPMVECs. Quantitative analysis of AT1R and Mas mRNA levels was carried out by RT-PCR. There were no significant differences in the AT1R mRNA level in Lv-P53 or Lv-shRNA-P53 groups as compared with the control group (Figure 3a). While the Mas mRNA level was attenuated by p53 overexpression and aggravated by p53 knockdown (Figure 3b). All data are expressed as the mean ± SD from at least three replicate experiments. *p < 0.05 versus the control group. AT1R: Angiotensin II receptor type 1; mRNA: messenger RNA; RT-PCR: real-time polymerase chain reaction; SD: standard deviation [Color figure can be viewed at wileyonlinelibrary.com]
3.4 NF-κB OR p53 knockdown inhibits LPS-induced apoptosis in HPMVECs
To investigate the role of NF-κB/p53 in LPS-induced HPMVEC apoptosis, p65 or p53 expression was knocked down in HPMVECs by lentiviral vectors, and the cells were then pretreated with Ang II, ARB, Ang-(1-7), or A779 followed by treatment with LPS. The results showed that treatment with Ang II or A779 enhanced the effect of LPS on HPMVEC apoptosis, and the effect was reversed by knockdown of p65 or p53 (Figure 4a,d). On the other hand, treatment with ARB or Ang-(1-7) attenuated the effect of LPS on cell apoptosis, and knockdown of p65 or p53 further diminished the effect (Figure 4b,c). These results suggest that roles of AT1R and Mas in LPS-induced HPMVEC apoptosis may depend on the NF-κB/p53 pathway.
Figure 4
Open in figure viewerPowerPoint
Effects of NF-κB or p53 knockdown on apoptosis in HPMVECs. FACS was used to detect apoptosis and then the vertical axis is the channel labeled with PI and the horizontal axis represents the channel of FITC-labeled annexin V probe. Ang II or A779 enhanced LPS-induced apoptosis, which was abolished by knockdown of p65 or p53 (Figure 4a,d). Additionally, apoptosis rate of HPMVECs pretreated with ARB or Ang-(1-7) was declined as compared with LPS-induced apoptosis, and knockdown of p65 or p53 further diminished apoptosis (Figure 4b,c). All data are expressed as the mean ± SD from at least three replicate experiments. *p < 0.05 versus the control group; #p < 0.05 versus the LPS group; $p < 0.05 versus the LPS+Ang II group; △p < 0.05 versus the LPS + ARB group; +p < 0.05 versus the LPS+Ang-(1-7) group; &p < 0.05 versus the LPS+A779 group. FACS: fluorescence-activated cell sorting; HPMVECs: human pulmonary microvascular endothelial cells; LPS: lipopolysaccharides; SD: standard deviation [Color figure can be viewed at wileyonlinelibrary.com]
3.5 The NF-κB/p53 pathway contributes to imbalance between AT1R and Mas
To examine the effect of NF-κB/p53 pathways on AT1R and Mas expression in LPS-induced HPMVEC apoptosis, p65 or p53 expression in HPMVECs was knocked down followed by treatment with either LPS alone or LPS plus Ang II, ARB, Ang-(1-7), or A779. The results showed that LPS treatment markedly induced AT1R protein expression, whereas significantly inhibiting Mas protein expression; Ang II enhanced the LPS-induced AT1R expression, which was counteracted by p65 knockdown but not by p53 knockdown (Figure 5a). In contrast, ARB downregulated LPS-induced AT1R protein level; this effect was further aggravated by p65 knockdown but not by p53 knockdown (Figure 5a). Both p65 knockdown and p53 knockdown reversed the effect of LPS plus Ang-(1-7) on AT1R expression that was suppressed by LPS. Compared with the LPS group, A779 pretreatment had no effect on AT1R expression. In addition, the AT1R expression was increased by p53 knockdown but not by p65 knockdown (Figure 5A).
Figure 5
Open in figure viewerPowerPoint
Effects of NF-κB p65 or p53 knockdown on AT1R and Mas expressions in HPMVECs. The levels of AT1R and Mas protein in HPMVECs were detected by western blot analysis. Ang II upregulated, whereas ARB and Ang-(1-7) downregulated LPS-induced AT1R expression. The AT1R protein levels were reversed by the p65 knockdown in either Ang II or Ang-(1-7) pretreatment groups but aggravated in ARB pretreatment group. As compared with LPS+Ang-(1-7) or LPS+A779 group, p53 knockdown enhanced the AT1R expression level (Figure 5a). Ang II and A779 aggravated, but Ang-(1-7) or ARB reserved LPS-induced suppression of the Mas expression. These Mas protein expressions were upregulated by both p65 and p53 knockdown (Figure 5b). All data are expressed as the mean ± SD from at least three replicate experiments. *p < 0.05 versus the control group; #p < 0.05 versus the LPS group; $p < 0.05 versus the LPS+Ang II group; △p < 0.05 versus the LPS+ARB group; Φp < 0.05 versus the LPS+Ang-(1-7) group; &p < 0.05 versus the LPS+A779 group. AT1R: Angiotensin II receptor type 1; HPMVECs: human pulmonary microvascular endothelial cells; LPS: lipopolysaccharides; SD: standard deviation [Color figure can be viewed at wileyonlinelibrary.com]
On the other hand, LPS-induced suppression of Mas expression was further aggravated by Ang II or A779 pretreatment and was reversed by ARB or Ang-(1-7) pretreatment. Knockdown of p65 or p53 significantly promoted Mas expression (Figure 5b).
These results demonstrated that LPS treatment regulated the balance between AT1R and Mas receptor. Ang II further enhanced the LPS-induced AT1R upregulation and aggravated LPS-induced suppression of the Mas expression. These effects were reversed by p65 knockdown. Meanwhile, Ang-(1-7) inhibited the expression of AT1R and increased Mas expression. The effects were reversed by p65 or p53 knockdown. These findings suggest that imbalance between AT1R and Mas is attributable to the NF-κB/p53 pathway in LPS-induced HPMVEC apoptosis.
3.6 P53 knockdown activates NF-κB
NF-κB has been shown to regulate p53 transcription (Figure 3). We next sought to test if p53 also regulates NF-κB. The results indicated that LPS treatment significantly induced the phosphorylation of NF-κB p65 that was further promoted by Ang II or A779 pretreatment and was reversed by Ang-(1-7) but not by ARB. Meanwhile, knockdown of p53 in HPMVECs markedly promoted the phosphorylation of NF-κB p65 in both Ang II or ARB and Ang-(1-7) or A779-pretreated cells (Figure 6a).
Figure 6
Open in figure viewerPowerPoint
Effects of NF-κB p65 or p53 knockdown on phosphorylation of p65 and p53 in HPMVECs. The levels of p-p65 and P53 protein in HPMVECs were detected by western blot analysis. Ang II or A779 promoted but Ang-(1-7) inhibited the LPS-induced phosphorylation of NF-κB p65 in HPMVECs. The phosphorylation of the NF-κB p65 level was downregulated by p65 knockdown and upregulated by the p53 knockdown in both Ang II or ARB or Ang-(1-7) or A779-pretreated cells (Figure 6a). Besides, both Ang-(1-7) and ARB attenuated LPS-induced p53 expression in HPMVECs. Knockdown of NF-κB p65 suppressed the p53 expression in ARB or Ang-(1-7) or A779-pretreated HPMVECs, whereas p53 knockdown decreased p53 level in Ang II or ARB or Ang-(1-7) or A779-pretreated HPMVECs (Figure 6b). All data are expressed as the mean ± SD from at least three replicate experiments. *p < 0.05 versus the control group; #p < 0.05 versus the LPS group; $p < 0.05 versus the LPS+Ang II group; △p < 0.05 versus the LPS+ARB group; Φp < 0.05 versus the LPS+Ang-(1-7) group; &p < 0.05 versus the LPS+A779 group. HPMVECs: human pulmonary microvascular endothelial cells; LPS: lipopolysaccharides; SD: standard deviation [Color figure can be viewed at wileyonlinelibrary.com]
In addition, LPS-induced the P53 expression was attenuated by Ang-(1-7) or ARB pretreatment but not by Ang II or A779. Knockdown of NF-κB p65 further suppressed the P53 expression in Ang-(1-7) or ARB or A779-pretreated HPMVECs but had no effect on the P53 expression in Ang II-pretreated HPMVECs (Figure 6b).
These results showed that LPS stimulation activated the NF-κB p65/p53 pathways, and p53 knockdown enhanced Ang II-induced activation of NF-κB p65. On the other hand, NF-κB p65 knockdown aggravated Ang1-7-inhibited p53 activity, and p53 knockdown reversed Ang1-7-suppressed NF-κB p65 activity. These data suggest that reciprocal regulation between NF-κB and p53 may contribute to the imbalance between AT1R and Mas in LPS-induced HPMVEC apoptosis.
4 DISCUSSION
In the present study, we investigated the role of p53 and the NF-κB p65 pathways in the regulation of AT1R and the Mas receptor expression in LPS-treated HPMVECs. LPS-induced HPMVEC apoptosis, which was further aggravated by Ang II or A779 pretreatment but alleviated by Ang-(1-7) or ARB pretreatment. Knockdown of either p53 or NF-κB p65 also inhibited LPS-induced-HPMVEC apoptosis, suggesting that the NF-κB/p53 pathway contributes to the development of ARDS. Furthermore, we found that Ang II pretreatment upregulated LPS-induced AT1R expression and p65 phosphorylation, and downregulated Mas expression while having no effect on LPS-induced p53. P65 knockdown suppressed AT1R expression but induced Mas expression. P53 knockdown did not appear to regulate the AT1R expression but could upregulate the Mas expression.
On the other hand, Ang-(1-7) treatment downregulated the expression of AT1R, p53, and phosphorylated p65 while upregulating the Mas expression. Knockdown of either p65 or p53 promoted both the AT1R and Mas expressions. Interestingly, p65 and p53 were regulated by each other: p65 knockdown inhibited the p53 expression, whereas p53 knockdown promoted phosphorylation of p65. Similar results were also observed with luciferase reporter gene assays. Collectively, regulation of AT1R and Mas by Ang II and Ang-(1-7) may be at least partially attributable to the p53 and the NF-κB pathway.
Ang II is an important peptide in RAS. Indeed, studies have shown that Ang II induces mRNA and protein expressions of AT1R in pancreatic ductal adenocarcinoma cell lines (Anandanadesan et al., 2008). Ang II also promotes the production and release of proinflammatory cytokines in macrophage through activation of NF-κB (Guo, Chen, & Wang, 2011). In addition, Ang II treatment inhibits the Mas expression in BLM-induced rat pulmonary fibrosis model (Meng, Yu et al., 2014; Meng, Li et al., 2014). Our study was consistent with these findings, suggesting that Ang II (through binding to its receptor AT1R) promotes the phosphorylation of NF-κB and then induces AT1R expression and inhibit Mas expression. However, Ang II pretreatment appears to have no effect on P53 expression, suggesting that p53 may be not involved in the effects of Ang II.
As an endogenous antagonist of Ang II, Ang-(1-7) treatment restores the balance between Ang II/AT1R and Ang-(1-7)/Mas. Chronic oral administration of Ang-(1-7) downregulates AT1R and upregulates Mas in dystrophic skeletal muscle (Sabharwal et al., 2014). Similar effects of Ang-(1-7) are also observed in hepatocellular carcinoma animal model and BLM-induced rat pulmonary fibrosis model (Meng, Yu et al., 2014; Meng, Li et al., 2014). Ang-(1-7) treatment inhibits Ang II-induced activation of the NF-kB pathway in HBVSMCs and cerebral microvessels (Liu, Li et al., 2015). Ang-(1-7) treatment could inhibit Ang II-induced activation of the NF-kB pathway in HBVSMCs and cerebral microvessels (Bihl et al., 2015). Our present study was consistent with the findings as mentioned above. The possible mechanism is that Ang-(1-7) attaches to Mas receptor and inhibits the NF-κB/p53 pathway, thus promoting the expression of Mas and suppressing the expression of AT1R.
The NF-κB family consists of five subunits, NF-κB1(p105/p50), NF-κB2(p100/p52), RelA(p65), RelB, and c-Rel. Under physiological conditions, NF-κB exists in an inactive cytoplasmic form via binding to IκB. Upon stimulation, IκB is rapidly phosphorylated and then degraded, which leads to the translocation of NF-κB into the nucleus, allowing it to regulate the transcription of inflammatory genes (Baldwin, 1996; Hayden & Ghosh, 2004). NF-κB activation contributes to pulmonary inflammation and the development of ARDS (Abraham, 2003; Fan, Ye, & Malik, 2001; Yunhe et al., 2012).
The P53 protein is a tumor suppressor and transcription factor and plays a key role in cell apoptosis and cell-cycle control. The precise molecular mechanisms underlying the essential function of p53 remain largely unknown (Moll, Wolff, Speidel, & Deppert, 2005; Vogelstein, Lane, & Levine, 2000; Vousden & Lane, 2007). Previous studies have shown that NF-κB and p53 may transcriptionally cross-regulate each other's activity. In some cases, the NF-κB and IKK pathways suppress p53 activity through inducing the HDM2 (or MDM2) expression (Tergaonkar, Pando, Vafa, Wahl, & Verma, 2002). NF-κB inhibition also decreases p53 transcriptional activity and protects against DNA damage-induced neuronal death (Aleyasin et al., 2004). p53 induces NF-κB activation by an IκB kinase-independent mechanism involving phosphorylation of p65 by ribosomal S6 kinase 1 (Bohuslav, Chen, Kwon, Mu, & Greene, 2004). In different cellular contexts, p53 also directly or indirectly suppresses NF-κB signaling (Hoffman, Biade, Zilfou, Chen, & Murphy, 2002; Kawauchi, Araki, Tobiume, & Tanaka, 2008a, 2008b; Perkins, 2007; Webster & Perkins, 1999). Our results showed that p53 knockdown promoted the LPS-induced phosphorylation of NF-κB p65 and p65 overexpression of upregulated p53. In addition, p65 knockdown further aggravated Ang-(1-7)-induced suppression of p53. These results showed reciprocal regulation between NF-κB and p53.
In summary, the data presented here suggest that Ang II promotes LPS-induced HPMVEC apoptosis and upregulates the AT1R expression via activating NF-κB p65, while downregulating the Mas expression via activating the NF-κB p65/p53 pathway. On the other hand, Ang-(1-7) attenuates LPS-induced cell apoptosis and upregulates the Mas expression through inhibiting the NF-κB p65/p53 pathway while suppressing AT1R expression through inhibiting NF-κB p65 activity. Taken together, our study demonstrates that there is a two-way feedback regulation between AT1R and Mas receptor via the NF-κB p65/p53 pathway, which contributes to LPS-induced HPMVECs apoptosis. The underlying mechanisms are shown in Figure 7.
Figure 7
Open in figure viewerPowerPoint
Diagram of the signaling pathway. It may be a two-way feedback regulation between AT1R and Mas receptor via NF-κB p65/p53 pathway, which contributes to LPS-induced HPMVECs apoptosis. AT1R: Angiotensin II receptor type 1; HPMVECs: human pulmonary microvascular endothelial cells; LPS: lipopolysaccharides [Color figure can be viewed at wileyonlinelibrary.com]
ACKNOWLEDGMENTS
This study was supported by the National Nature Science Foundation of China (No. 81272145) and Natural Science Foundation of Shanghai (No. 18ZR1428800).
CONFLICTS OF INTEREST
The authors declared that they have no conflicts of interest
